Identifikasi Polimorfisme Gen Interleukin-6 -385A/T dan -386A/T pada Wanita Postmenopause Suku Jawa dengan Osteoporosis

UTAMI, SRI LESTARI (2022) Identifikasi Polimorfisme Gen Interleukin-6 -385A/T dan -386A/T pada Wanita Postmenopause Suku Jawa dengan Osteoporosis. Univ.Wijaya Kusuma Surabaya. (Unpublished)

Text 10. REVIEWER.pdf Download (744kB)

Abstract

Abstract Research on genotypic variation in IL-6 gene polymorphisms -174G/C, -572G/C, - 597A/G, and -634C/G, and their gene expression in postmenopausal Javanese women with osteoporosis has been done. This study aims to identify other genotypic variations in the single nucleotide polymorphism (SNP) IL-6 gene in postmenopausal Javanese women with osteoporosis. The study was conducted on 66 Javanese postmenopausal women. The diagnosis of osteoporosis is made by DEXA on the femoral neck T-score. The IL-6 gene promoter polymorphism genotype will be identified by the Sanger method of one-way sequencing. The primers used for the IL-6 gene promoter are Primer 1: 5' – TCTGAACCAGCTTGAC CCAA – 3' and 5' – CTGTGAGGGGCTGTTGTAGA – 3' and Primer 2: 5' – AGCAGCCA ACCTCCTCTAAG – 3' and 5' – GAGCTTCTCTTTCGTTCCCG – 3'. The results of the sequencing will be homogenized with the gene bank. The SNP was identified in the IL-6 gene promoter at positions 385 and 386 with a base change from A to T. The sequence sizes of PCR products with primers 1 and 2 were 572 bp and 760 bp, respectively. The number and percentage of AA, AT, and TT genotypes in the IL-6-385A/T gene polymorphism were 51 (77.27%), 8 (12.12%), and 7 (10.6%). Meanwhile, the genotypes on IL-6-386A/T were AA with 60 (95.45%) and AT with 3 (4.5%). The numbers of A alleles in the IL-6-385A/T and IL-6-386A/T gene polymorphisms were 110 and 129, while the T alleles were 22 and 3. The new SNPs promoter IL-6 in postmenopausal Javanese with osteoporosis were - 385A/T and -386A/T. Keywords: IL6 gene promoter polymorphism, Javanese, postmenopausal women, osteoporosis

Item Type:	Other
Subjects:	R Medicine > R Medicine (General)
Divisions:	Faculty of Medicine > Medicine Study Program
Depositing User:	Sulimin BP3
Date Deposited:	14 Sep 2023 05:18
Last Modified:	14 Sep 2023 05:18
URI:	http://erepository.uwks.ac.id/id/eprint/15434

Actions (login required)

View Item

Downloads